| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.179533 |
| Chromosome: | chromosome 6 |
| Location: | 6351112 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g292000 | (1 of 1) PF00790//PF03127 - VHS domain (VHS) // GAT domain (GAT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCTCGAGCCTGGAGCACTCGAAACGTC |
| Internal bar code: | CGGATTCGATTCTAAGATGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 950 |
| LEAP-Seq percent confirming: | 99.7122 |
| LEAP-Seq n confirming: | 4851 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGAGTGTGAATGGGAGTG |
| Suggested primer 2: | AATCTTGCTCCCACAAGGTG |