| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.179764 |
| Chromosome: | chromosome 5 |
| Location: | 2505805 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g235750 | MSH6 | DNA mismatch repair protein, MutS homolog; (1 of 1) K08737 - DNA mismatch repair protein MSH6 (MSH6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAATGTCGGCACTTTTAACCTTGCAAAC |
| Internal bar code: | GGGTGACGGGACGCGGCAACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 99.0162 |
| LEAP-Seq n confirming: | 1409 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | AGCGTGTGGACACTAATCCC |