| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.180027 |
| Chromosome: | chromosome 12 |
| Location: | 3048500 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g500600 | VMA21 | (1 of 1) PF09446 - VMA21-like domain (VMA21); vacuolar ATPase assembly factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTCTTTGCAAGCCACCGCCCCATCCGT |
| Internal bar code: | TTTAGGGCTTGCAGTTTTCGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1091 |
| LEAP-Seq percent confirming: | 99.6443 |
| LEAP-Seq n confirming: | 7283 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTTCAGCCTCACTCGCAT |
| Suggested primer 2: | CAAAGGTGGAGGCAAAGAAG |