Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.181247 |
Chromosome: | chromosome 12 |
Location: | 3897956 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g515900 | TOPBP1,DIV21 | BRC-repeat-containing protein; (1 of 5) PF12738 - twin BRCT domain (PTCB-BRCT) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCCAGTTGCGAGGAGGTGCCGCCACC |
Internal bar code: | GGAGAAAAGAAGCCTTGATCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 596 |
LEAP-Seq percent confirming: | 98.8235 |
LEAP-Seq n confirming: | 420 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTCTTGTCCTTCGCATCA |
Suggested primer 2: | TGTGCAGGAAGTTCATCAGC |