Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.181489 |
Chromosome: | chromosome 10 |
Location: | 1533598 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429000 | UBC39 | E2 ubiquitin conjugating enzyme; (1 of 1) IPR000104//IPR000608//IPR016135 - Antifreeze protein, type I // Ubiquitin-conjugating enzyme E2 // Ubiquitin-conjugating enzyme/RWD-like | 5'UTR|intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTGACGATCTCCCTTTACTTCTGCATT |
Internal bar code: | GATACCGTTAATCGCTCGACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 334 |
LEAP-Seq percent confirming: | 99.7299 |
LEAP-Seq n confirming: | 2954 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATACGGCATATCAACGTGC |
Suggested primer 2: | GTGAAGGCTCACTTGAAGGC |