Insertion junction: LMJ.RY0402.181985_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.181985
Chromosome:chromosome_6
Location:5348382
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g283500 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGTAAGGGCTGGCGTAGGGCAGTGGGTACC
Internal bar code:GTTGACGAGGCAGATTGGGACT

Confirmation - LEAP-Seq

LEAP-Seq distance:412
LEAP-Seq percent confirming:96.0334
LEAP-Seq n confirming:920
LEAP-Seq n nonconfirming:38
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:CTTCATGGCATGGACTGTTG
Suggested primer 2:TACACCAAAAACCCGGTACG