| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.182107 |
| Chromosome: | chromosome 6 |
| Location: | 5108451 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281050 | VPS5A | (1 of 2) K17917 - sorting nexin-1/2 (SNX1_2); Subunit of Retromer complex | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACGTCTTGCGGGGCTTTACTGCGCACT |
| Internal bar code: | CCGTAGTCTCGATATCTAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 312 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 114 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGGACAGGTCTAATGGT |
| Suggested primer 2: | ACTTCCAGTTTGGTTGCTGG |