| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.182734 |
| Chromosome: | chromosome 17 |
| Location: | 4059297 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729250 | UPF2 | (1 of 1) K14327 - regulator of nonsense transcripts 2 (UPF2, RENT2); Putative UPF2 regulator of nonsense transcripts | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCGGGACATGTGGCAGTACGAGCGTCA |
| Internal bar code: | GGACCTCGGGACGTGGGCATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 99.3114 |
| LEAP-Seq n confirming: | 10673 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAAAGCCGAACCCAATGAA |
| Suggested primer 2: | ACGAAATCCAACACGGAGAG |