| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185107 |
| Chromosome: | chromosome 12 |
| Location: | 3628356 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514050 | GSF1 | (1 of 1) 1.4.7.1 - Glutamate synthase (ferredoxin) / Ferredoxin-dependent glutamate synthase; Ferredoxin-dependent glutamate synthase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAACTTGTGCGAGTACGGCTAGCACGC |
| Internal bar code: | GGCGCTGGGGATTAAGTCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1160 |
| LEAP-Seq percent confirming: | 99.7515 |
| LEAP-Seq n confirming: | 2810 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACCATCATTCACACCAAG |
| Suggested primer 2: | TCAGTGCGAGTGGACTTACG |