| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.185495 |
| Chromosome: | chromosome 1 |
| Location: | 3889745 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025300 | RAD51B | (1 of 1) K10869 - RAD51-like protein 1 (RAD51L1, RAD51B); DNA recombination protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTGCGGCCGACGGAGGAGCTGTCAGCT |
| Internal bar code: | TGCGAGTGGAAACTGCGTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 710 |
| LEAP-Seq percent confirming: | 98.5507 |
| LEAP-Seq n confirming: | 136 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAATTGCTGGGTATGGT |
| Suggested primer 2: | GTACTACGAAACTTGCCCGC |