| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.185851 |
| Chromosome: | chromosome 6 |
| Location: | 1105063 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256700 | (1 of 1) IPR014001//IPR026127//IPR027417 - Helicase superfamily 1/2, ATP-binding domain // Probable RNA helicase SDE3 // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAAGGGCAGCCACCGCAGAAGCCCCAGC |
| Internal bar code: | CAATACGCCCATATCTGGCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 85.0735 |
| LEAP-Seq n confirming: | 4685 |
| LEAP-Seq n nonconfirming: | 822 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGCACCAGAAAGTCGAT |
| Suggested primer 2: | CTGCGACAAATCCAGTGCTA |