Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.186364 |
Chromosome: | chromosome 10 |
Location: | 4458661 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451600 | SRR28,SRR28B | (1 of 1) PF00059//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4); Lectin-domain glycosyl hydrolase | CDS|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGTGCAGCTGCCCCCTTGCTGCCAAACC |
Internal bar code: | ATCTGAGTGGTAGAGATCCTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 166 |
LEAP-Seq percent confirming: | 96.1835 |
LEAP-Seq n confirming: | 2369 |
LEAP-Seq n nonconfirming: | 94 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACAATATGTGCGTGTTCG |
Suggested primer 2: | CCTGATCACATGTGGCAAAC |