Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.186841 |
Chromosome: | chromosome 1 |
Location: | 5379756 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g037800 | TRL7,TRX21 | (1 of 11) IPR012336//IPR013766 - Thioredoxin-like fold // Thioredoxin domain; Thioredoxin-like protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGATCGGTTCGGTGGATTTGCCCATGCA |
Internal bar code: | GCCGGTGGTGCATATTACCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 679 |
LEAP-Seq percent confirming: | 96.162 |
LEAP-Seq n confirming: | 451 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTTGGTGTTGGAGGTGAT |
Suggested primer 2: | GGGGTGAGCACGTGAGTATT |