Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.187220 |
Chromosome: | chromosome 4 |
Location: | 2260125 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g220200 | (1 of 1) PTHR16254:SF13 - K(+) EFFLUX ANTIPORTER 1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGCCTGTACCGCTTTTCCAAACATCCC |
Internal bar code: | GCCTCCAGTCGCCGAGCTGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1 |
LEAP-Seq percent confirming: | 99.0476 |
LEAP-Seq n confirming: | 416 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
Suggested primer 2: | CTACAAAGCCCCTACCACCA |