Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.187311 |
Chromosome: | chromosome 6 |
Location: | 3148663 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275350 | ROC40 | (1 of 1) PTHR12802//PTHR12802:SF43 - SWI/SNF COMPLEX-RELATED // PROTEIN CCA1-RELATED; Rhythm Of Chloroplast 40 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGGAAAGGCAGAGCGGAGGAAGCGTG |
Internal bar code: | ACCACGCCGCGCTGGGAAAAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 714 |
LEAP-Seq percent confirming: | 90.0361 |
LEAP-Seq n confirming: | 3244 |
LEAP-Seq n nonconfirming: | 359 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGAAACTGCAACCCGTATC |
Suggested primer 2: | ATCACAAATGGGGCAAATGT |