| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.187346 |
| Chromosome: | chromosome 17 |
| Location: | 6041259 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741050 | LCV1,COV1 | COV1-like protein; (1 of 1) PF04367 - Protein of unknown function (DUF502) (DUF502) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGAATGGCCATGCCGCAAGACACGACG |
| Internal bar code: | AGTCGGTTCTAAGGGCCAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 898 |
| LEAP-Seq percent confirming: | 99.752 |
| LEAP-Seq n confirming: | 4424 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATACGGTAGCAGGCACCAC |
| Suggested primer 2: | GGTAAAAGCGCGCTAACTTG |