| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.188813 |
| Chromosome: | chromosome 2 |
| Location: | 2701039 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093500 | SSD1 | Sterol sensing 5-transmembrane protein; (1 of 1) PF03176 - MMPL family (MMPL) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCAGGGTCAGGGTCAAGGCTATCCCTGA |
| Internal bar code: | TGGCTGGTGGCATTCCGTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1063 |
| LEAP-Seq percent confirming: | 79.7297 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACCCAGCATAGCATTTA |
| Suggested primer 2: | GCATTGCCATGTATGACCAG |