Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.189429 |
Chromosome: | chromosome 16 |
Location: | 2976800 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g664301 | POLQ1 | DNA polymerase theta; (1 of 2) K02349 - DNA polymerase theta [EC:2.7.7.7] (POLQ) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAAATGAAGAATGTAAGGGCGGTGCAAGC |
Internal bar code: | CGACGGGTTTGGGCCGAGCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 170 |
LEAP-Seq percent confirming: | 99.802 |
LEAP-Seq n confirming: | 1008 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGGCACACAAGCAATCTA |
Suggested primer 2: | GGAAGGGCGCCTTTTTATAG |