| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.189891 |
| Chromosome: | chromosome 10 |
| Location: | 1991784 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g432450 | (1 of 29) PF13637 - Ankyrin repeats (many copies) (Ank_4) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATCTCAAGGTGTTGATACGTAATGTCG |
| Internal bar code: | TACAGTCATGCTAATCGGCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 98.6341 |
| LEAP-Seq n confirming: | 6860 |
| LEAP-Seq n nonconfirming: | 95 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTGAAGCGGAGTTGAGG |
| Suggested primer 2: | GGACAATGGTAGAGGCCAGA |