| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.190065 |
| Chromosome: | chromosome_6 |
| Location: | 2648975 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre06.g269950 | EZY21,CDC48,NSG14 | Protein involved in ubiquitin-dependent degradation of ER-bound | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | ATACTTGCTCCTCCTCCCACAGCCGCCCGC |
| Internal bar code: | ACATGGCGTGAGGTCATATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 99.6678 |
| LEAP-Seq n confirming: | 300 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTGTGTTGTTCTACGGC |
| Suggested primer 2: | AAACAATCGTCGCCACCTAC |