| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.190903 |
| Chromosome: | chromosome 1 |
| Location: | 76394 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000500 | AXL5,ERR3 | Arabinose chain extension enzyme like protein 5; (1 of 6) PTHR10994//PTHR10994:SF61 - RETICULON // RETICULON-LIKE PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAATCCGTTCATGCCTATATTCATGTT |
| Internal bar code: | CTGGGGTATTGGCAGCCAGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 98.3051 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCCTTGTGACCTTATGC |
| Suggested primer 2: | GTACGGCCTTTCAGGAATCA |