| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.191469 |
| Chromosome: | chromosome 4 |
| Location: | 2954071 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224750 | VAM1,VAMP1,VAMP71 | Endosomal R-SNARE protein, Vamp7/Nyv1-family (R.III); (1 of 3) PTHR21136//PTHR21136:SF4 - SNARE PROTEINS // N-SYNAPTOBREVIN, ISOFORM J | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAAGGCTTGGGGCGCGCGTGTCCTGCG |
| Internal bar code: | GAGATCTGAGCGAACTCCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1028 |
| LEAP-Seq percent confirming: | 99.6415 |
| LEAP-Seq n confirming: | 4447 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGACGATGTGGCCTAAGT |
| Suggested primer 2: | TATGCGTTGCAGTGGTCTTC |