| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.192273 |
| Chromosome: | chromosome 16 |
| Location: | 6157078 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675500 | FKB16-5,FKB8,FKB16E | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 25) PTHR10516 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGACGTTCAGGTTGAAGTGACCAGAGTC |
| Internal bar code: | GACAGCCGCTCGAGAAGGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 970 |
| LEAP-Seq percent confirming: | 97.0267 |
| LEAP-Seq n confirming: | 2219 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACATCATCATCAGCCAG |
| Suggested primer 2: | GTATGGAGACAGCGTGAGCA |