| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.192294 |
| Chromosome: | chromosome 13 |
| Location: | 1616283 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g573450 | CPS | Putative cleavage and polyadenylation specificity factor subunit 1; (1 of 1) K14401 - cleavage and polyadenylation specificity factor subunit 1 (CPSF1, CFT1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCGATTAGACTCATCAGCCGCACACTC |
| Internal bar code: | CACCTCGTATAAGTTGGGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 547 |
| LEAP-Seq percent confirming: | 32.8289 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 2175 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGAAGCGATCCTCATACC |
| Suggested primer 2: | AGCCACTATACATGAGCCCG |