| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.193283 |
| Chromosome: | chromosome 12 |
| Location: | 1683932 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g485800 | FTSH1,FHL1 | FtsH-like membrane ATPase/metalloprotease; (1 of 1) PTHR23076//PTHR23076:SF33 - METALLOPROTEASE M41 FTSH // ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 1, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTCGATCGTGCGAAAGGCCCGAAAGGCC |
| Internal bar code: | TCAACAGGCTGGCGAGGTAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 557 |
| LEAP-Seq percent confirming: | 98.7988 |
| LEAP-Seq n confirming: | 2303 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGCCTGATCTGTCTTTCA |
| Suggested primer 2: | CAAGAGCTGTAGAGGGGACG |