Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.195292 |
Chromosome: | chromosome 9 |
Location: | 4546102 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396139 | (1 of 5) K14326 - regulator of nonsense transcripts 1 (UPF1, RENT1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTCCTCGCTCTCCGCCCACTCCTCCTGC |
Internal bar code: | CAGAAGAACGTCACCGGGACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 222 |
LEAP-Seq percent confirming: | 99.795 |
LEAP-Seq n confirming: | 3895 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCCCATCACTCCGTTCTC |
Suggested primer 2: | TGGTTAAGGGGGAGTAGGCT |