| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.197641 |
| Chromosome: | chromosome 10 |
| Location: | 1533515 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429000 | UBC39 | E2 ubiquitin conjugating enzyme; (1 of 1) IPR000104//IPR000608//IPR016135 - Antifreeze protein, type I // Ubiquitin-conjugating enzyme E2 // Ubiquitin-conjugating enzyme/RWD-like | 5'UTR|intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCCGTAGGGTGCAGTAATTCCCAGACC |
| Internal bar code: | CGCCAGACTCCGAGTCCTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1109 |
| LEAP-Seq percent confirming: | 99.7439 |
| LEAP-Seq n confirming: | 3116 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAAGGCTCACTTGAAGGC |
| Suggested primer 2: | CATACGGCATATCAACGTGC |