| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.197772 |
| Chromosome: | chromosome 2 |
| Location: | 2001360 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088400 | DEG1,DEG1A | (1 of 3) PTHR22939:SF81 - PROTEASE DO-LIKE 1, CHLOROPLASTIC; Deg protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGAATCGCCTGCGCACTCCACCAGCTGC |
| Internal bar code: | ACCTCTAGTGCCACGGAAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 683 |
| LEAP-Seq percent confirming: | 98.6772 |
| LEAP-Seq n confirming: | 373 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTAAGAAGGGCGTGTGGG |
| Suggested primer 2: | GTGACTACGGAATGCGTGTG |