| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.198331 |
| Chromosome: | chromosome 16 |
| Location: | 5274492 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g682550 | (1 of 1) PF08016//PF08263//PF13855 - Polycystin cation channel (PKD_channel) // Leucine rich repeat N-terminal domain (LRRNT_2) // Leucine rich repeat (LRR_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCATTGCTTGCATGCGACTCATCAAGC |
| Internal bar code: | TCGGCAAATGATTGCGCCAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 961 |
| LEAP-Seq percent confirming: | 94.4373 |
| LEAP-Seq n confirming: | 1477 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCGCTGGTATAAATGCTA |
| Suggested primer 2: | TGATGCATTCGAAGTTGAGC |