Insertion junction: LMJ.RY0402.199030_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.199030
Chromosome:chromosome_14
Location:474404
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre14.g611100 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCTGCACTGCCTGTGCGCGCACGCGCCCG
Internal bar code:CCAAGGGAGCGGAGGCGATTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:140
LEAP-Seq percent confirming:99.7817
LEAP-Seq n confirming:457
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:TTGGCTTGGTTTAGTTTGGG
Suggested primer 2:CTGTCCATGGAGGATGGAGT