Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199226 |
Chromosome: | chromosome 10 |
Location: | 2815212 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g439350 | (1 of 3) PTHR17130:SF24 - GAN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCAACCGTGCCCGTACGACGTGTGCGC |
Internal bar code: | TTGGTATCCTCCGTGAGGAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 932 |
LEAP-Seq percent confirming: | 99.8541 |
LEAP-Seq n confirming: | 4790 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGTGGACTGAGCAAGTGA |
Suggested primer 2: | GTCGAAGTTGGGCACGTAGT |