| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.200112 |
| Chromosome: | chromosome 12 |
| Location: | 4800809 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524300 | CGL71,PYG7 | (1 of 7) 2.4.1.255 - Protein O-GlcNAc transferase / OGTase; Pale yellow green 7, a PSI assembly factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCATCGCGCACGGGCAGCTTGAAGGCGAG |
| Internal bar code: | CATGGTTAATTACTTTCGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 158 |
| LEAP-Seq percent confirming: | 98.6207 |
| LEAP-Seq n confirming: | 143 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACTCCCTAGCACCACCAC |
| Suggested primer 2: | CATTTGCATCATCCTGCATC |