| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202267 |
| Chromosome: | chromosome 3 |
| Location: | 7481316 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205600 | IoJAP,RSF1 | (1 of 1) PTHR21043//PTHR21043:SF1 - IOJAP SUPERFAMILY ORTHOLOG // PROTEIN IOJAP, CHLOROPLASTIC; Putative chloroplast ribosome silencing factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTATACGGTAAACCGGACACCCCGGCCGG |
| Internal bar code: | CTTAACGGACACAAACCTATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 610 |
| LEAP-Seq percent confirming: | 84.3148 |
| LEAP-Seq n confirming: | 1489 |
| LEAP-Seq n nonconfirming: | 277 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGACTTCCTGCTCACCT |
| Suggested primer 2: | CAGGCGTGAAGGGTACAAAT |