| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202415 |
| Chromosome: | chromosome 12 |
| Location: | 4802244 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524350 | HUS1 | DNA damage checkpoint protein; (1 of 1) K10903 - HUS1 checkpoint protein (HUS1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGGACGGCTGCTGCGGCACCTGACACG |
| Internal bar code: | GCCAGGAATAGCGGGGCCTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 99.6587 |
| LEAP-Seq n confirming: | 292 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTGGTGCTAGGGAGTGT |
| Suggested primer 2: | GATGGTTGGGGTGGTGTAAG |