Insertion junction: LMJ.RY0402.202796_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.202796
Chromosome:chromosome_1
Location:374261
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g002300 CYN19-2,CYN4 Peptidyl-prolyl cis-trans isomerase, cyclophilin-type sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TCCAGCACGGGGTGAGCTGGCGCTCCGCTT
Internal bar code:AACGTCGGCGCAAACAGCGCAT

Confirmation - LEAP-Seq

LEAP-Seq distance:919
LEAP-Seq percent confirming:99.5951
LEAP-Seq n confirming:1230
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:GCGACCATCATTACAGGCTT
Suggested primer 2:ACAGCACAGCGACATAGGTG