| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.202796 |
| Chromosome: | chromosome 1 |
| Location: | 374261 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002300 | CYN4,CYN19B,CYN19-2,ROC1 | (1 of 4) K01802 - peptidylprolyl isomerase (E5.2.1.8); Cyclophilin 19-2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCACGGGGTGAGCTGGCGCTCCGCTT |
| Internal bar code: | AACGTCGGCGCAAACAGCGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 919 |
| LEAP-Seq percent confirming: | 99.5951 |
| LEAP-Seq n confirming: | 1230 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGACCATCATTACAGGCTT |
| Suggested primer 2: | ACAGCACAGCGACATAGGTG |