| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.203593 |
| Chromosome: | chromosome 13 |
| Location: | 4176321 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592150 | PRP28,SPL28 | (1 of 1) K12858 - ATP-dependent RNA helicase DDX23/PRP28 (DDX23, PRP28); DEAD/DEAH box helicase, possible nuclear pre-mRNA splicing factor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCACGTACTATACACCTCGCACCCTTG |
| Internal bar code: | CGTCTATTTCTCGCCTGTTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCACCAAACAGGTTATCT |
| Suggested primer 2: | CCATTCACCACTGATGTTGC |