Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.204504 |
Chromosome: | chromosome 13 |
Location: | 4037641 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g591100 | MSCL3,MSC5 | (1 of 1) IPR000104//IPR002048//IPR006685//IPR010920 - Antifreeze protein, type I // EF-hand domain // Mechanosensitive ion channel MscS // LSM domain; Predicted protein with mechanosensitive ion channel domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGAATGTGAACTGAACATGAAGTTGAAC |
Internal bar code: | GTGTAGCGAAAATGGGGTTATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 781 |
LEAP-Seq percent confirming: | 99.5563 |
LEAP-Seq n confirming: | 14584 |
LEAP-Seq n nonconfirming: | 65 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGGGGCTGGTATCTACAGG |
Suggested primer 2: | CACCAACAGCAAAATGCAAC |