Insertion junction: LMJ.RY0402.205078_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.205078
Chromosome:chromosome_3
Location:3050096
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCGCCTCCTTGCCAGCCGAAGGCCTTTCCG
Internal bar code:CCCCGTAATAGAGGGCGCTAGA

Confirmation - LEAP-Seq

LEAP-Seq distance:375
LEAP-Seq percent confirming:99.6823
LEAP-Seq n confirming:2824
LEAP-Seq n nonconfirming:9
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:GAGACTGCCCAGAAGCAATC
Suggested primer 2:CGAGGTGGTGATTGTGGAG