| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.206618 |
| Chromosome: | chromosome 12 |
| Location: | 3417883 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496700 | TRX17,TRL3 | (1 of 4) PTHR10438//PTHR10438:SF255 - THIOREDOXIN // THIOREDOXIN M4, CHLOROPLASTIC; Thioredoxin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTGACAAGGAAGAGAGGTCCAGTGGGC |
| Internal bar code: | CTGGATATGTGGCGGCGGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1088 |
| LEAP-Seq percent confirming: | 96.0535 |
| LEAP-Seq n confirming: | 9687 |
| LEAP-Seq n nonconfirming: | 398 |
| LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAAGCCATATAGGAACGC |
| Suggested primer 2: | TAGTTGAGACACGCCACGTC |