| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.207024 |
| Chromosome: | chromosome 12 |
| Location: | 4259860 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g519300 | TEF9 | (1 of 2) PF13301 - Protein of unknown function (DUF4079) (DUF4079); conserved expressed protein, possible chloroplast localization | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCATTTGTGCCTCTCAACTCTCTAGTGT |
| Internal bar code: | CAGTGGACAAGAGATCGGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 866 |
| LEAP-Seq percent confirming: | 98.4309 |
| LEAP-Seq n confirming: | 1631 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACCCGCTACAAATGATG |
| Suggested primer 2: | ACCACGTGTTAACAGCCTCC |