Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.208357 |
Chromosome: | chromosome 13 |
Location: | 1297241 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g571050 | High mobility group protein; (1 of 1) PF00505//PF01388 - HMG (high mobility group) box (HMG_box) // ARID/BRIGHT DNA binding domain (ARID) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGACAGGAGAGCTCCCTGCTGCAAGCATC |
Internal bar code: | TCACCCCACGCGTTGACCCCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 548 |
LEAP-Seq percent confirming: | 10.7143 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 150 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCAGGTGCTAACTGGTCC |
Suggested primer 2: | CCCCTATTCCACGTCAACAT |