Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.208586 |
Chromosome: | chromosome 16 |
Location: | 6153856 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g675550 | FKB16-2,FKB5,FKB16B | (1 of 2) PTHR10516//PTHR10516:SF281 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // 12 KDA FK506-BINDING PROTEIN; Peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGCATGCTATGTACCATACTGACCAG |
Internal bar code: | CATCGCGAGTATCCTATGGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 828 |
LEAP-Seq percent confirming: | 99.7297 |
LEAP-Seq n confirming: | 3689 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCAACCAATGCTATAACG |
Suggested primer 2: | GCTGACTGAGCAAAACCCTC |