| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.209790 |
| Chromosome: | chromosome 1 |
| Location: | 850183 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g004350 | ROC105,ROC77,ALIX,NAT3,HLM1 | (1 of 1) K12200 - programmed cell death 6-interacting protein (PDCD6IP, ALIX, RIM20); Histone-lysine N-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGTGGCCTACACAAGGCAGTGGAGGA |
| Internal bar code: | CCAACTCTATACGTCGGTCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 846 |
| LEAP-Seq percent confirming: | 98.7785 |
| LEAP-Seq n confirming: | 6793 |
| LEAP-Seq n nonconfirming: | 84 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGAAATTGGTGTGTCAG |
| Suggested primer 2: | CATGGCTTGGCTGATGTATG |