| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.209861 |
| Chromosome: | chromosome 14 |
| Location: | 969988 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g613950 | ABCA2,ABC2 | (1 of 2) 3.6.3.32 - Quaternary-amine-transporting ATPase; ABC lipid exporter 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCTGGGCGCAGCCACCGTGGGCACCAA |
| Internal bar code: | CGACGGGCCTTAAGGCGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1027 |
| LEAP-Seq percent confirming: | 97.5897 |
| LEAP-Seq n confirming: | 5709 |
| LEAP-Seq n nonconfirming: | 141 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGCTGTTCTTCCTGTTC |
| Suggested primer 2: | CCCCTAACACACTGCACCTT |