| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.210873 |
| Chromosome: | chromosome 11 |
| Location: | 3251556 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479750 | SRP54,cpSRP54,SRP54L | Chloroplast SRP54; (1 of 1) PTHR11564:SF7 - SIGNAL RECOGNITION PARTICLE 54 KDA PROTEIN, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGGTGGCCTGAGGCGGCATGGTACGGA |
| Internal bar code: | CGGCCAAGTCTCGATCTAGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 933 |
| LEAP-Seq percent confirming: | 85.8283 |
| LEAP-Seq n confirming: | 4300 |
| LEAP-Seq n nonconfirming: | 710 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTCGCATGACACAGAAT |
| Suggested primer 2: | ACGGGACTACGCTAACCCTT |