| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211236 |
| Chromosome: | chromosome 6 |
| Location: | 4118947 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278221 | TSSP1,TPS1,TSPSP1 | (1 of 1) 2.4.1.15//3.1.3.12 - Alpha,alpha-trehalose-phosphate synthase (UDP-forming) / UDP-glucose--glucose-phosphate glucosyltransferase // Trehalose-phosphatase / Trehalose 6-phosphate phosphatase; Trehalose-6-phosphate synthase/phosphatase, class I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATGGCATTGCATTACCAAATATATACT |
| Internal bar code: | CCTTGTCGGCGTATGGAACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 99.6569 |
| LEAP-Seq n confirming: | 581 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGACGCATTGTTACACCA |
| Suggested primer 2: | TTCTTTTGGCGCTGTTTTCT |