Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.211267 |
Chromosome: | chromosome 5 |
Location: | 3076465 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239000 | (1 of 1) IPR006626//IPR011050//IPR011989//IPR012334 - Parallel beta-helix repeat // Pectin lyase fold/virulence factor // Armadillo-like helical // Pectin lyase fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAACAGCCAGTTACTGGGCGCGCTGGCC |
Internal bar code: | TAACAACTTGGACACAAGGCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 363 |
LEAP-Seq percent confirming: | 88.8641 |
LEAP-Seq n confirming: | 14340 |
LEAP-Seq n nonconfirming: | 1797 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGCAACAGTAAGGGGTGC |
Suggested primer 2: | CATGGTGGTTGTGCTAATGC |