| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212335 |
| Chromosome: | chromosome 16 |
| Location: | 2082406 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657550 | (1 of 1) PF08553 - VID27 cytoplasmic protein (VID27) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTCACAGCCATAGCCTCACACCTCCTG |
| Internal bar code: | CTGCTGTGTAAAGCACCAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 795 |
| LEAP-Seq percent confirming: | 97.4435 |
| LEAP-Seq n confirming: | 1639 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATTGCTTTGCTGGGGTTG |
| Suggested primer 2: | AGACCACCTACGTGGACGAC |