| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212826 |
| Chromosome: | chromosome 17 |
| Location: | 782288 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701700 | FAB2 | Plastid acyl-ACP desaturase; (1 of 2) K03921 - acyl- (DESA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCATGCGCGGCTGTTATGATGCGGCCG |
| Internal bar code: | TATTAAGTGTCTTGGGAACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 99.3506 |
| LEAP-Seq n confirming: | 765 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATTAGCGAGCCAGTAAG |
| Suggested primer 2: | AGGAATAGCTGTGGTGGTGG |