| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.213475 |
| Chromosome: | chromosome 13 |
| Location: | 5196926 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g608000 | CPLD52 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR10366//PTHR10366:SF389 - NAD DEPENDENT EPIMERASE/DEHYDRATASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGTTATAAGTGCTATCCCCTCACCTCCC |
| Internal bar code: | GTGCCGGTGACCGACTCGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 927 |
| LEAP-Seq percent confirming: | 99.4536 |
| LEAP-Seq n confirming: | 4368 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAACGTGCTTTTGCTGTC |
| Suggested primer 2: | CTGCTATTTGCGTGCGTTTA |